Hépatite B fulminante associée à une insertion spécifique dans la région de base du promoteur de l’ADN du virus de l’hépatite B après un traitement immunosuppresseur

La réactivation du virus de l’hépatite B après un traitement immunosuppresseur chez un patient antigène négatif de surface hépatite B avec des anticorps détectables contre l’antigène nucléocapsidique de l’hépatite B et l’antigène de surface de l’hépatite B a révélé une insertion bp dans la région promotrice de l’hépatite. l’ADN du virus, créant un nouveau site de liaison au facteur nucléaire des hépatocytes. Ceci a conduit à une réplication virale améliorée et à une hépatite fulminante.

La réactivation de la réplication du virus de l’hépatite B est une complication bien connue chez les patients atteints d’infection chronique par le VHB qui reçoivent un traitement immunosuppresseur Dans ces situations, une réplication virale accrue secondaire à la diminution de la réponse immunologique entraîne une infection généralisée du VHB. La restauration d’un statut immunologique normal peut ensuite induire une lésion hépatique massive et une hépatite fulminante La majorité des patients rapportés dans la littérature ont été positifs pour l’antigène de surface de l’hépatite B HBsAg avant de recevoir un traitement immunosuppresseur Néanmoins, dans de rares cas, la réactivation du VHB a été décrite. patients négatifs Chez ces patients, la survenue de variants du VHB pourrait être associée à un résultat clinique sévère Nous décrivons un patient initialement testé positif aux anticorps anti-HBs de l’hépatite B de surface présentant une réactivation du VHB après un traitement au cyclophosphamide Chez ce patient, le L’émergence d’une insertion bp spécifique dans la région promotrice du VHB a coïncidé avec une insuffisance hépatique fulminante. Une patiente a été suivie pour l’histiocytose cutanée de Langerhans. Le traitement par cyclophosphamide mg par jour a débuté pour la première fois en avril et a été Pendant ce temps, les résultats des tests de la fonction hépatique se situaient dans les limites normales. Le patient était guéri d’une infection par le VHB, car les résultats des tests anti-HBs et anti-HBc anti-HBc étaient positifs. L’évolution clinique de l’éruption cutanée a été favorable et le traitement a été interrompu. Une rechute est survenue et une deuxième cure de cyclophosphamide a été prescrite en juin et s’est poursuivie pendant des mois. Les résultats des tests de la fonction hépatique sont restés dans les limites normales pendant le suivi. En juillet, le patient a été admis dans notre établissement de l’Hôpital de la Conception, à Marseille, en France, omission Les résultats des tests de la fonction hépatique ont montré des élévations marquées – aussi élevées que les niveaux normaux – de l’alanine aminotransférase IU / L et de l’aspartate aminotransférase IU / L, ainsi que de l’hyperbilirubinémie niveau de bilirubine, μmol / L; niveau normal, & lt; Le résultat des tests sérologiques de l’hépatite B a révélé que le patient était positif pour l’antigène HBsAg, l’antigène HBeAg négatif pour l’hépatite B et l’antigène HBc négatif, et positif pour les anticorps contre l’antigène e de l’hépatite B anti-HBe L’hépatite aiguë liée à l’infection par le VHB a été confirmée par la présence d’IgM anti-HBc et le taux élevé d’ADN du VHB × copies / mL dans les échantillons sériques obtenus en juillet. L’ADN du VHB a été détecté avec le test Amplicor HBV Monitor. Un diagnostic de réactivation du VHB secondaire à un traitement immunosuppresseur a été posé, et le patient a reçu un traitement par lamivudine mg tous les jours pendant des semaines; par la suite, le résultat clinique est rapidement devenu défavorable et le patient est décédé d’une insuffisance hépatique. Une analyse rétrospective des marqueurs sérologiques de l’hépatite B a révélé que le patient était considéré comme guéri en novembre, en raison de l’absence d’HBsAg et de la présence d’anticorps anti-HBs. L En juin, les résultats des tests sérologiques effectués avant le début du deuxième traitement avec le cyclophosphamide ont révélé que la réapparition apparente de HBsAg HBeAg était simultanément présente dans le sérum. Les résultats des tests de la fonction hépatique étaient normaux. À la fin du deuxième cours En février, les résultats des tests sérologiques HBV ont montré que la persistance du HBsAg, l’absence de l’HBeAg détectable auparavant et l’apparition de taux sériques anti-HBe d’aspartate aminotransférase et d’alanine aminotransférase restaient dans la plage des valeurs normales.

Tableau View largeTélécharger la lameEvolution des marqueurs sérologiques et des signes cliniques avant, pendant et après un traitement immunosuppresseur chez un patient infecté par le virus de l’hépatite BVHVTable View largeTélécharger diapositiveEvolution des marqueurs sérologiques et des signes cliniques avant, pendant et après un traitement immunosuppresseur chez un patient atteint d’hépatite B Infection par le virus HBV Après ultracentrifugation d’un échantillon de sérum à, g pendant h, l’ADN viral a été extrait à l’aide du mini kit Qiagen DNA Qiagen L’amplification d’un fragment de bp comprenant le promoteur principal, le precore et les gènes de base a été réalisée amplification utilisée TGCATAAGAGGACTCTTGGA comme amorce directe et AAAGCCCCGTAAAGTTTCCCA comme amorce inverse Au second tour, μL d’ADN utilisé au premier tour a été amplifié en utilisant TGCATAAGAGGACTCTTGGA comme amorce directe et TTATGTGTCCAAGGAATACT comme amorce inverse. Le fragment de PCR amplifié a été directement séquencé en utilisant le Cycle de Big Dye Terminator seq Les séquences obtenues ont été alignées et ont été comparées à la séquence de référence du HBV. GenBank numéro d’accès AF Le gène pol a été amplifié en utilisant la PCR nichée et a été séquencé du premier au dernier. codon du gène RT, c’est-à-dire des nucléotides – en utilisant des procédures similaires à celles décrites ci-dessus. Comme le montre la figure, l’analyse directe du gène nucléocapsidique montre une insertion bp dans la région promotrice du noyau basal entre nucléotide et nucléotide. n’a observé aucune autre mutation dans le gène du noyau ou dans les gènes de la polymérase du VHB. En particulier, les mutations classiques dans la région du promoteur du noyau basal, c’est-à-dire la mutation et le gène précore, et les mutations n’ont pas été trouvées.

Figure Vue largeDownload slideAnnophorégramme correspondant à la région promotrice du noyau basal de nucléotide à nucléotide pour le sommet de séquence de type sauvage et pour la séquence du patient bas L’insertion -bp entre nucléotide et nucléotide est encadrée entre les flèchesFigure View largeDownload slideUn électrophorégramme correspondant au basal L’insertion du -bp entre le nucléotide et le nucléotide est encadrée entre les flèches. L’insertion correspond à la séquence GTTAATCATTA. Cette insertion -bp était identique et se trouvait exactement dans la région du promoteur nucléocapsidique du nucléotide au nucléotide. même emplacement que celui décrit par Pult et al dans le VHB d’un receveur d’une transplantation cardiaque mort d’une hépatite B fulminante transmise par le donneurDiscussion Dans le présent rapport, nous décrivons un cas de réactivation de la réplication du VHB qui a conduit à une hépatite fulminante. échec après un traitement immunosuppresseur La réactivation du VHB est une complication bien connue chez les patients atteints d’infection chronique par le VHB qui reçoivent un traitement immunosuppresseur ou des agents chimiothérapeutiques La restauration d’une réponse immunitaire efficace après le retrait de l’agent thérapeutique peut induire une hépatite grave avec un pronostic fatal. Chez nos patients La plupart des patients ayant été décrits dans la littérature étaient positifs pour l’HBsAg avant le début du traitement immunosuppresseur. Cependant, certaines études ont souligné la possibilité d’une réactivation du VHB chez des patients initialement positifs aux anticorps anti-HBs , Comme dans le cas du patient décrit dans Lok et al , la réactivation du VHB est survenue chez% des patients positifs à l’anti-HBs et chez moins de% des patients HBsAg positifs à la chimiothérapie. Dans notre observation, la réactivation de la prolifération du HBV était associée à l’émergence d’un variant du VHB Cette souche mutante du VHB était principalement présente dans le sérum sam. En effet, au cours de la première phase du traitement, le cyclophosphamide induit la réactivation du VHB de type sauvage, comme le suggèrent à la fois la séroconversion HBsAg et la séroconversion HBeAg. Dans la deuxième phase, HBeAg / anti-HBe une séroconversion est apparue, suggérant le développement d’une souche du VHB avec une mutation du promoteur du noyau L’impact de ces mutations sur les résultats de l’infection par le VHB est toujours discuté Des variantes du promoteur du VHB ont été décrites chez des patients immunodéprimés. sont porteurs symptomatiques ou asymptomatiques de l’infection chronique par le VHB, ainsi que chez les patients atteints d’hépatite fulminante Chez les patients que nous décrivons, le variant VHB hébergeait une insertion bp dans la région promotrice du noyau du génome du VHB. Dans ce dernier cas, l’insertion de -bp dans la région du promoteur du noyau a été montré pour créer un nouvel hépato site de liaison du facteur nucléaire de cyte- HNF dans la séquence d’ADN du VHB et pour améliorer la réplication virale in vitro De telles mutations dans le promoteur nucléotidique du VHB se sont accumulées chez des patients immunodéprimés et pourraient être associées à un résultat plus sévère [ ] Il convient de souligner que, dans notre observation, ainsi que dans le rapport de Pult et al , l’insertion -bp dans la région promotrice du noyau était associée à une insuffisance hépatique fulminante. Ceci suggère évidemment que cette insertion bp une contribution directe à l’évolution clinique fulminante de la réactivation du VHB En conclusion, le cas que nous décrivons souligne la nécessité d’un suivi actif de la réplication du VHB, même chez les patients positifs en anti-HBs recevant un traitement immunosuppresseur. le traitement par des agents immunosuppresseurs peut favoriser la survenue de mutations du promoteur nucléocapsidique spécifiquement associées à l’hépatite fulminante

Remerciements

Conflits d’intérêts potentiels Tous les auteurs: pas de conflits